Q1. Given below are two statements :
Statement I : Ligaments are dense irregular tissue.
Statement II : Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below :
Statement I : Ligaments are dense irregular tissue.
Statement II : Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (a)
Ligaments are dense regular. Cartilage is specialized connective tissue.
Ligaments are dense regular. Cartilage is specialized connective tissue.
Q2. Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
Correct Answer: (d)
Habitat loss and fragmentation is the most significant cause of driving animals and plants to extinction.
Habitat loss and fragmentation is the most significant cause of driving animals and plants to extinction.
Q3. The thickness of ozone in a column of air in the atmosphere is measured in terms of :
Correct Answer: (d)
Ozone thickness is measured in Dobson units (DU).
Ozone thickness is measured in Dobson units (DU).
Q4. Cellulose does not form blue colour with Iodine because
Correct Answer: (b)
Starch forms helical secondary structures holding iodine (blue), but Cellulose does not form complex helices.
Starch forms helical secondary structures holding iodine (blue), but Cellulose does not form complex helices.
Q5. Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by -
Correct Answer: (a)
Ileo-caecal valve prevents backflow from caecum to ileum.
Ileo-caecal valve prevents backflow from caecum to ileum.
Q6. Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
Correct Answer: (a)
Option 1 contains only Australian marsupials. Others mix placental mammals (Mole, Flying Squirrel, Lemur, Bobcat) with marsupials.
Option 1 contains only Australian marsupials. Others mix placental mammals (Mole, Flying Squirrel, Lemur, Bobcat) with marsupials.
Q7. Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly ?
Correct Answer: (a)
Hepatitis-B, HIV, and Genital herpes are not completely curable. Gonorrhoea is.
Hepatitis-B, HIV, and Genital herpes are not completely curable. Gonorrhoea is.
Q8. Which of the following statements are correct?
A. An excessive loss of body fluid from the body switches off osmoreceptors.
B. ADH facilitates water reabsorption to prevent diuresis.
C. ANF causes vasodilation.
D. ADH causes increase in blood pressure.
E. ADH is responsible for decrease in GFR.
Choose the correct answer from the options given below:
A. An excessive loss of body fluid from the body switches off osmoreceptors.
B. ADH facilitates water reabsorption to prevent diuresis.
C. ANF causes vasodilation.
D. ADH causes increase in blood pressure.
E. ADH is responsible for decrease in GFR.
Choose the correct answer from the options given below:
Correct Answer: (a)
A is false (switches ON). B is true. C is true. D is true (constricts vessels). E is false (prevents fall in GFR).
A is false (switches ON). B is true. C is true. D is true (constricts vessels). E is false (prevents fall in GFR).
Q9. Which hormone promotes internode/petiole elongation in deep water rice?
Correct Answer: (b)
Ethylene promotes rapid internode/petiole elongation in deep water rice plants.
Ethylene promotes rapid internode/petiole elongation in deep water rice plants.
Q10. Given below are two statements :
Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below:
Statement I : The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II : Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.
In the light of the above statements, choose the most appropriate answer from the options given below:
Correct Answer: (d)
Both statements regarding transpiration pull and evaporative cooling are correct.
Both statements regarding transpiration pull and evaporative cooling are correct.
Q11. The phenomenon of pleiotropism refers to
Correct Answer: (b)
Pleiotropy is when a single gene exhibits multiple phenotypic expressions.
Pleiotropy is when a single gene exhibits multiple phenotypic expressions.
Q12. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below:
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below:
Correct Answer: (b)
Assertion is true. Reason is false because pollen tube IS formed (siphonogamy) in gymnosperms.
Assertion is true. Reason is false because pollen tube IS formed (siphonogamy) in gymnosperms.
Q13. Which of the following combinations is required for chemiosmosis?
Correct Answer: (d)
Chemiosmosis requires a membrane, a proton pump, a proton gradient and ATP synthase.
Chemiosmosis requires a membrane, a proton pump, a proton gradient and ATP synthase.
Q14. Match List I with List II with respect to human eye.
| List I | List II |
|---|---|
| A. Fovea | I. Visible coloured portion of eye that regulates diameter of pupil. |
| B. Iris | II. External layer of eye formed of dense connective tissue. |
| C. Blind spot | III. Point of greatest visual acuity or resolution. |
| D. Sclera | IV. Point where optic nerve leaves the eyeball and photoreceptor cells are absent. |
Correct Answer: (d)
Fovea-Acuity (III), Iris-Coloured (I), Blind spot-Optic nerve (IV), Sclera-External layer (II).
Fovea-Acuity (III), Iris-Coloured (I), Blind spot-Optic nerve (IV), Sclera-External layer (II).
Q15. Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of R.B.Cs formation
Choose the correct answer from the options given below:
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of R.B.Cs formation
Choose the correct answer from the options given below:
Correct Answer: (b)
Sleep-wake cycle (Melatonin) and Immune system (Thymosin) are not controlled by Thyroid. Others are.
Sleep-wake cycle (Melatonin) and Immune system (Thymosin) are not controlled by Thyroid. Others are.
Q16. In the equation GPP – R = NPP
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is ____.
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is ____.
Correct Answer: (b)
R stands for Respiratory loss.
R stands for Respiratory loss.
Q17. Match List I with List II:
| List I | List II |
|---|---|
| A. M Phase | I. Proteins are synthesized |
| B. G₂ Phase | II. Inactive phase |
| C. Quiescent stage | III. Interval between mitosis and initiation of DNA replication |
| D. G₁ Phase | IV. Equational division |
Correct Answer: (b)
M Phase-Equational (IV), G2-Proteins synthesized (I), Quiescent-Inactive (II), G1-Interval (III).
M Phase-Equational (IV), G2-Proteins synthesized (I), Quiescent-Inactive (II), G1-Interval (III).
Q18. What is the function of tassels in the corn cob?
Correct Answer: (a)
The tassels (stigma and style) wave in the wind to trap pollen grains.
The tassels (stigma and style) wave in the wind to trap pollen grains.
Q19. Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by
Correct Answer: (b)
Alfred Sturtevant used the frequency of recombination between gene pairs on the same chromosome as a measure of the distance between genes and ‘mapped’ their position on the chromosome.
Alfred Sturtevant used the frequency of recombination between gene pairs on the same chromosome as a measure of the distance between genes and ‘mapped’ their position on the chromosome.
Q20. The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
Correct Answer: (a)
During Pachytene, recombination nodules appear, which are sites for crossing over.
During Pachytene, recombination nodules appear, which are sites for crossing over.
Q21. How many ATP and NADPH₂ are required for the synthesis of one molecule of Glucose during Calvin cycle?
Correct Answer: (a)
6 turns of Calvin cycle are required for 1 Glucose. Per turn: 3 ATP + 2 NADPH. Total: 18 ATP + 12 NADPH.
6 turns of Calvin cycle are required for 1 Glucose. Per turn: 3 ATP + 2 NADPH. Total: 18 ATP + 12 NADPH.
Q22. Movement and accumulation of ions across a membrane against their concentration gradient can be explained by
Correct Answer: (c)
Active transport moves molecules against a concentration gradient requiring energy (ATP).
Active transport moves molecules against a concentration gradient requiring energy (ATP).
Q23. Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason R : Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below :
Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason R : Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (c)
Assertion is false (Sex determination is banned, not a strategy). Reason is true.
Assertion is false (Sex determination is banned, not a strategy). Reason is true.
Q24. Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell.
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.
Choose the correct answer from the options given below:
A. Insertion of recombinant DNA into the host cell.
B. Cutting of DNA at specific location by restriction enzyme.
C. Isolation of desired DNA fragment.
D. Amplification of gene of interest using PCR.
Choose the correct answer from the options given below:
Correct Answer: (d)
Sequence: Cutting (B) -> Isolation (C) -> PCR (D) -> Insertion (A).
Sequence: Cutting (B) -> Isolation (C) -> PCR (D) -> Insertion (A).
Q25. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below :
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (d)
In winter, the cambium is less active and forms fewer xylary elements that have narrow vessels, and this wood is called autumn wood or late wood.
In winter, the cambium is less active and forms fewer xylary elements that have narrow vessels, and this wood is called autumn wood or late wood.
Q26. Match List I with List II.
| List I | List II |
|---|---|
| A. Mast cells | I. Ciliated epithelium |
| B. Inner surface of bronchiole | II. Areolar connective tissue |
| C. Blood | III. Cuboidal epithelium |
| D. Tubular parts of nephron | IV. specialised connective tissue |
Correct Answer: (b)
Mast cells-Areolar (II), Bronchiole-Ciliated (I), Blood-Specialised (IV), Nephron tubules-Cuboidal (III).
Mast cells-Areolar (II), Bronchiole-Ciliated (I), Blood-Specialised (IV), Nephron tubules-Cuboidal (III).
Q27. Match List I with List II :
| List I | List II |
|---|---|
| A. Cohesion | I. More attraction in liquid phase |
| B. Adhesion | II. Mutual attraction among water molecules |
| C. Surface tension | III. Water loss in liquid phase |
| D. Guttation | IV. Attraction towards polar surfaces |
Correct Answer: (d)
Cohesion-Mutual attraction (II), Adhesion-Polar surfaces (IV), Surface tension-More attraction in liquid (I), Guttation-Liquid loss (III).
Cohesion-Mutual attraction (II), Adhesion-Polar surfaces (IV), Surface tension-More attraction in liquid (I), Guttation-Liquid loss (III).
Q28. Expressed Sequence Tags (ESTs) refers to
Correct Answer: (d)
ESTs refers to identifying all genes that are expressed as RNA.
ESTs refers to identifying all genes that are expressed as RNA.
Q29. Match List I with List II.
| List I | List II |
|---|---|
| A. Heroin | I. Effect on cardiovascular system |
| B. Marijuana | II. Slow down body function |
| C. Cocaine | III. Painkiller |
| D. Morphine | IV. Interfere with transport of dopamine |
Correct Answer: (d)
Heroin-Slow down (II), Marijuana-Cardiovascular (I), Cocaine-Dopamine (IV), Morphine-Painkiller (III).
Heroin-Slow down (II), Marijuana-Cardiovascular (I), Cocaine-Dopamine (IV), Morphine-Painkiller (III).
Q30. Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
Correct Answer: (d)
Fabaceae typically has diadelphous stamens (9+1 arrangement). Solanaceae has epipetalous, Liliaceae has epiphyllous stamens.
Fabaceae typically has diadelphous stamens (9+1 arrangement). Solanaceae has epipetalous, Liliaceae has epiphyllous stamens.
Q31. Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
Correct Answer: (a)
Spraying juvenile conifers with GAs hastens the maturity period, thus leading to early seed production.
Spraying juvenile conifers with GAs hastens the maturity period, thus leading to early seed production.
Q32. In which blood corpuscles, the HIV undergoes replication and produces progeny viruses ?
Correct Answer: (d)
HIV targets and replicates within Helper T cells (CD4 cells).
HIV targets and replicates within Helper T cells (CD4 cells).
Q33. Match List I with List II.
| List I (Type of Joint) | List II (Found between) |
|---|---|
| A. Cartilaginous Joint | I. Between flat skull bones |
| B. Ball and Socket Joint | II. Between adjacent vertebrae in vertebral column |
| C. Fibrous Joint | III. Between carpal and metacarpal of thumb |
| D. Saddle Joint | IV. Between Humerus and Pectoral girdle |
Correct Answer: (a)
Cartilaginous-Vertebrae (II), Ball&Socket-Humerus/Pectoral (IV), Fibrous-Skull (I), Saddle-Thumb (III).
Cartilaginous-Vertebrae (II), Ball&Socket-Humerus/Pectoral (IV), Fibrous-Skull (I), Saddle-Thumb (III).
Q34. Match List I with List II :
| List I | List II |
|---|---|
| A. Oxidative decarboxylation | I. Citrate synthase |
| B. Glycolysis | II. Pyruvate dehydrogenase |
| C. Oxidative phosphorylation | III. Electron transport sytem |
| D. Tricarboxylic acid cycle | IV. EMP pathway |
Correct Answer: (c)
Oxidative decarboxylation-Pyruvate DH (II), Glycolysis-EMP (IV), Oxidative phosphorylation-ETS (III), TCA-Citrate synthase (I).
Oxidative decarboxylation-Pyruvate DH (II), Glycolysis-EMP (IV), Oxidative phosphorylation-ETS (III), TCA-Citrate synthase (I).
Q35. Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Endometrium is necessary for implantation of blastocyst.
Reason R : In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
In the light of the above statements, choose the correct answer from the options given below :
Assertion A : Endometrium is necessary for implantation of blastocyst.
Reason R : In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (a)
Both statements are true facts, but R explains why endometrium disintegrates, not why it is necessary for implantation.
Both statements are true facts, but R explains why endometrium disintegrates, not why it is necessary for implantation.
Q36. Match List I with List II :
| List I (Interaction) | List II (Species A and B) |
|---|---|
| A. Mutualism | I. +(A), O(B) |
| B. Commensalism | II. –(A), O(B) |
| C. Amensalism | III. +(A), –(B) |
| D. Parasitism | IV. +(A), +(B) |
Correct Answer: (a)
Mutualism (+,+), Commensalism (+,0), Amensalism (-,0), Parasitism (+,-).
Mutualism (+,+), Commensalism (+,0), Amensalism (-,0), Parasitism (+,-).
Q37. Which micronutrient is required for splitting of water molecule during photosynthesis?
Correct Answer: (d)
Manganese and Chlorine are involved in the photolysis of water.
Manganese and Chlorine are involved in the photolysis of water.
Q38. Given below are statements : one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Nephrons are of two types : Cortical & Juxta medullary, based on their relative position in cortex and medulla.
Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.
In the light of the above statements, choose the correct answer from the options given below :
Assertion A : Nephrons are of two types : Cortical & Juxta medullary, based on their relative position in cortex and medulla.
Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop of Henle.
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (b)
Assertion is true. Reason is false (Juxta medullary have long loops, cortical have short).
Assertion is true. Reason is false (Juxta medullary have long loops, cortical have short).
Q39. Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
Correct Answer: (a)
Males have anal styles, females do not.
Males have anal styles, females do not.
Q40. The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year:
Correct Answer: (a)
The Earth Summit was held in Rio de Janeiro in 1992.
The Earth Summit was held in Rio de Janeiro in 1992.
Q41. Given below are two statements :
Statement I : Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II : In general, carnivores are more adversely affected by competition than herbivores.
In the light of the above statements, choose the correct answer from the options given below:
Statement I : Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II : In general, carnivores are more adversely affected by competition than herbivores.
In the light of the above statements, choose the correct answer from the options given below:
Correct Answer: (b)
Statement I is correct. Statement II is false (Herbivores are more adversely affected).
Statement I is correct. Statement II is false (Herbivores are more adversely affected).
Q42. Match List I with List II.
| List I | List II |
|---|---|
| (A) CCK | (I) Kidney |
| (B) GIP | (II) Heart |
| (C) ANF | (III) Gastric gland |
| (D) ADH | (IV) Pancreas |
Correct Answer: (d)
CCK-Pancreas (IV), GIP-Gastric gland (III), ANF-Heart (II), ADH-Kidney (I).
CCK-Pancreas (IV), GIP-Gastric gland (III), ANF-Heart (II), ADH-Kidney (I).
Q43. Identify the correct statements:
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
E. Phellogen is single-layered in thickness.
Choose the correct answer from the options given below:
A. Lenticels are the lens-shaped openings permitting the exchange of gases.
B. Bark formed early in the season is called hard bark.
C. Bark is a technical term that refers to all tissues exterior to vascular cambium.
D. Bark refers to periderm and secondary phloem.
E. Phellogen is single-layered in thickness.
Choose the correct answer from the options given below:
Correct Answer: (a)
A is correct. B is incorrect (early is soft bark). C is incorrect (Bark is non-technical term). D is correct. E is incorrect (couple of layers).
A is correct. B is incorrect (early is soft bark). C is incorrect (Bark is non-technical term). D is correct. E is incorrect (couple of layers).
Q44. Radial symmetry is NOT found in adults of phylum _________.
Correct Answer: (a)
Hemichordates are bilaterally symmetrical.
Hemichordates are bilaterally symmetrical.
Q45. Identify the pair of heterosporous pteridophytes among the following :
Correct Answer: (a)
Genera like Selaginella and Salvinia which produce two kinds of spores, macro (large) and micro (small) spores, are known as heterosporous.
Genera like Selaginella and Salvinia which produce two kinds of spores, macro (large) and micro (small) spores, are known as heterosporous.
Q46. Upon exposure to UV radiation, DNA stained with ethidium bromide will show
Correct Answer: (c)
EtBr stained DNA fluoresces bright orange under UV light.
EtBr stained DNA fluoresces bright orange under UV light.
Q47. Match List I with List II.
| List I | List II |
|---|---|
| A. Ringworm | I. Haemophilus influenzae |
| B. Filariasis | II. Trichophyton |
| C. Malaria | III. Wuchereria bancrofti |
| D. Pneumonia | IV. Plasmodium vivax |
Correct Answer: (d)
Ringworm-Trichophyton (II), Filariasis-Wuchereria (III), Malaria-Plasmodium (IV), Pneumonia-Haemophilus (I).
Ringworm-Trichophyton (II), Filariasis-Wuchereria (III), Malaria-Plasmodium (IV), Pneumonia-Haemophilus (I).
Q48. Match List I with List II.
| List I | List II |
|---|---|
| A. Gene 'a' | I. β-galactosidase |
| B. Gene 'y' | II. Transacetylase |
| C. Gene 'i' | III. Permease |
| D. Gene 'z' | IV. Repressor protein |
Correct Answer: (a)
Gene a-Transacetylase (II), Gene y-Permease (III), Gene i-Repressor (IV), Gene z-Beta gal (I).
Gene a-Transacetylase (II), Gene y-Permease (III), Gene i-Repressor (IV), Gene z-Beta gal (I).
Q49. The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are :
Correct Answer: (d)
Limbic system (with hypothalamus) regulates emotional behavior.
Limbic system (with hypothalamus) regulates emotional behavior.
Q50. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (d)
Both are true and R explains A.
Both are true and R explains A.
Q51. Which of the following statements is correct ?
Correct Answer: (a)
Biomagnification definition is correct. Others are factually incorrect.
Biomagnification definition is correct. Others are factually incorrect.
Q52. Match List I with List II.
| List I | List II |
|---|---|
| A. Taenia | I. Nephridia |
| B. Paramoecium | II. Contractile vacuole |
| C. Periplaneta | III. Flame cells |
| D. Pheretima | IV. Urecose gland |
Correct Answer: (b)
Taenia-Flame cells (III), Paramoecium-Contractile vacuole (II), Periplaneta-Urecose gland (IV), Pheretima-Nephridia (I).
Taenia-Flame cells (III), Paramoecium-Contractile vacuole (II), Periplaneta-Urecose gland (IV), Pheretima-Nephridia (I).
Q53. Large, colourful, fragrant flowers with nectar are seen in:
Correct Answer: (d)
Insect pollinated flowers are large, colourful, fragrant and rich in nectar to attract pollinators.
Insect pollinated flowers are large, colourful, fragrant and rich in nectar to attract pollinators.
Q54. Which of the following stages of meiosis involves division of centromere?
Correct Answer: (b)
Splitting of centromere occurs during Anaphase II (and Anaphase of Mitosis).
Splitting of centromere occurs during Anaphase II (and Anaphase of Mitosis).
Q55. Given below are two statements :
Statement I : A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal).
Statement II : Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two subunits β type.)
In the light of the above statements, choose the correct answer from the options given below :
Statement I : A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal).
Statement II : Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two subunits β type.)
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (c)
Statement I is false (Left is N-terminal, Right is C-terminal). Statement II is true.
Statement I is false (Left is N-terminal, Right is C-terminal). Statement II is true.
Q56. Which of the following statements are correct ?
A. Basophils are most abundant cells of the total WBCs
B. Basophils secrete histamine, serotonin and heparin
C. Basophils are involved in inflammatory response
D. Basophils have kidney shaped nucleus
E. Basophils are agranulocytes
Choose the correct answer from the options given below:
A. Basophils are most abundant cells of the total WBCs
B. Basophils secrete histamine, serotonin and heparin
C. Basophils are involved in inflammatory response
D. Basophils have kidney shaped nucleus
E. Basophils are agranulocytes
Choose the correct answer from the options given below:
Correct Answer: (b)
Basophils are granulocytes, least abundant, have twisted nucleus, involved in inflammation and secrete histamine/serotonin/heparin. B and C are correct.
Basophils are granulocytes, least abundant, have twisted nucleus, involved in inflammation and secrete histamine/serotonin/heparin. B and C are correct.
Q57. In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are:
Correct Answer: (b)
Synergids (n), Zygote (2n), PEN (3n).
Synergids (n), Zygote (2n), PEN (3n).
Q58. Match List I with List II.
| List I (Cells) | List II (Secretion) |
|---|---|
| A. Peptic cells | I. Mucus |
| B. Goblet cells | II. Bile juice |
| C. Oxyntic cells | III. Proenzyme pepsinogen |
| D. Hepatic cells | IV. HCl and intrinsic factor for absorption of vitamin B₁₂ |
Correct Answer: (b)
Peptic-Pepsinogen (III), Goblet-Mucus (I), Oxyntic-HCl (IV), Hepatic-Bile (II).
Peptic-Pepsinogen (III), Goblet-Mucus (I), Oxyntic-HCl (IV), Hepatic-Bile (II).
Q59. Given below are two statements:
Statement I : During G₀ phase of cell cycle, the cell is metabolically inactive.
Statement II : The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below :
Statement I : During G₀ phase of cell cycle, the cell is metabolically inactive.
Statement II : The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below :
Correct Answer: (c)
Statement I is incorrect (G0 cells are metabolically active). Statement II is correct.
Statement I is incorrect (G0 cells are metabolically active). Statement II is correct.
Q60. Given below are two statements :
Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below :
Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (d)
Both statements are correct biological principles.
Both statements are correct biological principles.
Q61. Given below are two statements:
Statement I : RNA mutates at a faster rate.
Statement II : Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below :
Statement I : RNA mutates at a faster rate.
Statement II : Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (d)
Both statements are correct.
Both statements are correct.
Q62. Identify the correct statements :
A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes during mineralization.
C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.
D. The detritus food chain begins with living organisms.
E. Earthworms break down detritus into smaller particles by a process called catabolism.
Choose the correct answer from the option given below :
A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes during mineralization.
C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.
D. The detritus food chain begins with living organisms.
E. Earthworms break down detritus into smaller particles by a process called catabolism.
Choose the correct answer from the option given below :
Correct Answer: (d)
Statement D is incorrect (begins with dead organic matter). Statement E is incorrect (breaking down into smaller particles is fragmentation, catabolism is enzymatic degradation). A, B, C are correct.
Statement D is incorrect (begins with dead organic matter). Statement E is incorrect (breaking down into smaller particles is fragmentation, catabolism is enzymatic degradation). A, B, C are correct.
Q63. Which of the following statements are correct about Klinefelter's Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below:
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below:
Correct Answer: (b)
A is false (Down described Down syndrome). C is false (Tall). D is Down syndrome feature. B and E are correct.
A is false (Down described Down syndrome). C is false (Tall). D is Down syndrome feature. B and E are correct.
Q64. The unique mammalian characteristics are :
Correct Answer: (a)
Hairs, external ear (pinna) and mammary glands are unique to mammals.
Hairs, external ear (pinna) and mammary glands are unique to mammals.
Q65. Which one of the following symbols represents mating between relatives in human pedigree analysis?
Correct Answer: (a)
Double line between male and female represents mating between relatives (consanguineous mating).
Double line between male and female represents mating between relatives (consanguineous mating).
Q66. In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as:
Correct Answer: (a)
Differentiated cells (mesophyll) reverting to undifferentiated state (callus) is dedifferentiation.
Differentiated cells (mesophyll) reverting to undifferentiated state (callus) is dedifferentiation.
Q67. Broad palm with single palm crease is visible in a person suffering from -
Correct Answer: (d)
Simian crease (single palm crease) is characteristic of Down's syndrome.
Simian crease (single palm crease) is characteristic of Down's syndrome.
Q68. Which one of the following statements is NOT correct?
Correct Answer: (a)
Algal blooms deteriorate water quality and cause fish mortality.
Algal blooms deteriorate water quality and cause fish mortality.
Q69. Match List I with List II.
| List I | List II |
|---|---|
| A. Logistic growth | I. Unlimited resource availability condition |
| B. Exponential growth | II. Limited resource availability condition |
| C. Expanding age pyramid | III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups |
| D. Stable age pyramid | IV. The percent individuals of pre-reproductives and reproductive age group are same |
Correct Answer: (d)
Logistic-Limited (II), Exponential-Unlimited (I), Expanding-Pre>Rep (III), Stable-Pre=Rep (IV).
Logistic-Limited (II), Exponential-Unlimited (I), Expanding-Pre>Rep (III), Stable-Pre=Rep (IV).
Q70. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from the options given below:
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from the options given below:
Correct Answer: (d)
Both statements are correct. The development from spores explains why it's the first stage.
Both statements are correct. The development from spores explains why it's the first stage.
Q71. Match List I with List II.
| List I | List II |
|---|---|
| A. P - wave | I. Beginning of systole |
| B. Q - wave | II. Repolarisation of ventricles |
| C. QRS complex | III. Depolarisation of atria |
| D. T - wave | IV. Depolarisation of ventricles |
Correct Answer: (d)
P wave-Atrial depol (III), Q wave-Systole begin (I), QRS-Ventricular depol (IV), T wave-Repolarisation (II).
P wave-Atrial depol (III), Q wave-Systole begin (I), QRS-Ventricular depol (IV), T wave-Repolarisation (II).
Q72. Given below are two statements :
Statement I : Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
Statement II : The cavity of the cervix is called cervical canal which along with vagina forms birth canal.
In the light of the above statements, choose the correct answer from the options given below :
Statement I : Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
Statement II : The cavity of the cervix is called cervical canal which along with vagina forms birth canal.
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (d)
Both statements correctly describe male and female reproductive anatomy.
Both statements correctly describe male and female reproductive anatomy.
Q73. Given below are two statements:
Statement I : Electrostatic precipitator is most widely used in thermal power plant.
Statement II : Electrostatic precipitator in thermal power plant removes ionising radiations
In the light of the above statements, choose the most appropriate answer from the options given below :
Statement I : Electrostatic precipitator is most widely used in thermal power plant.
Statement II : Electrostatic precipitator in thermal power plant removes ionising radiations
In the light of the above statements, choose the most appropriate answer from the options given below :
Correct Answer: (b)
Statement I is correct. Statement II is false (Removes particulate matter, not radiation).
Statement I is correct. Statement II is false (Removes particulate matter, not radiation).
Q74. The reaction centre in PS II has an absorption maxima at
Correct Answer: (d)
PS II reaction centre is P680 (680 nm), PS I is P700.
PS II reaction centre is P680 (680 nm), PS I is P700.
Q75. What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Correct Answer: (a)
RNA Pol III transcribes tRNA, 5S rRNA, and snRNAs.
RNA Pol III transcribes tRNA, 5S rRNA, and snRNAs.
Q76. Which of the following statements are correct regarding skeletal muscle ?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:
Correct Answer: (a)
A is false (Fascicle is the bundle, layer is Fascia). B is true. C is true. D is false (Sarcomere is between Z lines).
A is false (Fascicle is the bundle, layer is Fascia). B is true. C is true. D is false (Sarcomere is between Z lines).
Q77. Which of the following functions is carried out by cytoskeleton in a cell ?
Correct Answer: (b)
Cytoskeleton (cilia/flagella/filaments) is involved in motility.
Cytoskeleton (cilia/flagella/filaments) is involved in motility.
Q78. Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment ?
Correct Answer: (a)
Serum/Urine analysis are conventional methods and often detect disease only after symptoms appear (late diagnosis).
Serum/Urine analysis are conventional methods and often detect disease only after symptoms appear (late diagnosis).
Q79. How many different proteins does the ribosome consist of?
Correct Answer: (d)
Ribosomes consist of RNAs and about 80 different proteins.
Ribosomes consist of RNAs and about 80 different proteins.
Q80. Which of the following are NOT considered as the part of endomembrane system ?
A. Mitochondria
B. Endoplasmic Reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below :
A. Mitochondria
B. Endoplasmic Reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below :
Correct Answer: (a)
ER, Golgi, Lysosomes and Vacuoles form the endomembrane system. Mitochondria, Chloroplasts, Peroxisomes are distinctive.
ER, Golgi, Lysosomes and Vacuoles form the endomembrane system. Mitochondria, Chloroplasts, Peroxisomes are distinctive.
Q81. Select the correct statements with reference to chordates.
A. Presence of mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system
C. Presence of paired pharyngeal gillslits
D. Presence of dorsal heart
E. Triploblastic pseudocoelomate animals
Choose the correct answer from the options given below:
A. Presence of mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system
C. Presence of paired pharyngeal gillslits
D. Presence of dorsal heart
E. Triploblastic pseudocoelomate animals
Choose the correct answer from the options given below:
Correct Answer: (a)
A (False, hollow single dorsal), B (True), C (True), D (False, ventral heart), E (False, coelomate).
A (False, hollow single dorsal), B (True), C (True), D (False, ventral heart), E (False, coelomate).
Q82. Unequivocal proof that DNA is the genetic material was first proposed by
Correct Answer: (a)
Hershey and Chase (1952) provided unequivocal proof using bacteriophages.
Hershey and Chase (1952) provided unequivocal proof using bacteriophages.
Q83. Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?
5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'?
Correct Answer: (b)
Coding strand is same as mRNA (with T instead of U) and same polarity (5'-3').
Coding strand is same as mRNA (with T instead of U) and same polarity (5'-3').
Q84. Axile placentation is observed in
Correct Answer: (c)
Axile placentation is found in China rose, Tomato, and Lemon (and Petunia/Solanaceae).
Axile placentation is found in China rose, Tomato, and Lemon (and Petunia/Solanaceae).
Q85. Which of the following statements are correct regarding female reproductive cycle ?
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below :
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below :
Correct Answer: (c)
B is incorrect (called menarche). A, C, D are correct.
B is incorrect (called menarche). A, C, D are correct.
Q86. Match List I with List II.
| List I (Interacting species) | List II (Name of Interaction) |
|---|---|
| A. A Leopard and a Lion in a forest/grassland | I. Competition |
| B. A Cuckoo laying egg in a Crow's nest | II. Brood parasitism |
| C. Fungi and root of a higher plant in Mycorrhizae | III. Mutualism |
| D. A cattle egret and a Cattle in a field | IV. Commensalism |
Correct Answer: (d)
Leopard/Lion-Competition (I), Cuckoo/Crow-Brood parasitism (II), Fungi/Root-Mutualism (III), Egret/Cattle-Commensalism (IV).
Leopard/Lion-Competition (I), Cuckoo/Crow-Brood parasitism (II), Fungi/Root-Mutualism (III), Egret/Cattle-Commensalism (IV).
Q87. Vital capacity of lung is______ .
Correct Answer: (c)
Vital Capacity (VC) = TV + IRV + ERV.
Vital Capacity (VC) = TV + IRV + ERV.
Q88. Select the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:
Correct Answer: (a)
A (False, Zygotene/Pachytene), B (True for Mitosis/Anaphase II), C (False, Diakinesis), D (True), E (False, non-sister chromatids).
A (False, Zygotene/Pachytene), B (True for Mitosis/Anaphase II), C (False, Diakinesis), D (True), E (False, non-sister chromatids).
Q89. Malonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
Correct Answer: (d)
Malonate is a competitive inhibitor of Succinic dehydrogenase.
Malonate is a competitive inhibitor of Succinic dehydrogenase.
Q90. During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
Correct Answer: (a)
Purified DNA precipitates out after the addition of chilled ethanol.
Purified DNA precipitates out after the addition of chilled ethanol.
Q91. In gene gun method used to introduce alien DNA into host cells, microparticles of _______ metal are used.
Correct Answer: (b)
Biolistics or gene gun method uses micro-particles of gold or tungsten coated with DNA.
Biolistics or gene gun method uses micro-particles of gold or tungsten coated with DNA.
Q92. Given below are two statements:
Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below;
Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below;
Correct Answer: (c)
Statement I is incorrect (describes primary xylem, not secondary). Statement II is correct (Roots are exarch).
Statement I is incorrect (describes primary xylem, not secondary). Statement II is correct (Roots are exarch).
Q93. Match List I with List II :
| List I | List II |
|---|---|
| A. Iron | I. Synthesis of auxin |
| B. Zinc | II. Component of nitrate reductase |
| C. Boron | III. Activator of catalase |
| D. Molybdenum | IV. Cell elongation and differentiation |
Correct Answer: (b)
Iron-Catalase (III), Zinc-Auxin (I), Boron-Cell elongation (IV), Molybdenum-Nitrate reductase (II).
Iron-Catalase (III), Zinc-Auxin (I), Boron-Cell elongation (IV), Molybdenum-Nitrate reductase (II).
Q94. Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.
In the light of the above statements, choose the correct answer from the options given below:
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.
In the light of the above statements, choose the correct answer from the options given below:
Correct Answer: (d)
Both are true and R explains A.
Both are true and R explains A.
Q95. In cockroach, excretion is brought about by-
A. Phallic gland
B. Urecose gland
C. Nephrocytes
D. Fat body
E. Collaterial glands
Choose the correct answer from the options given below:
A. Phallic gland
B. Urecose gland
C. Nephrocytes
D. Fat body
E. Collaterial glands
Choose the correct answer from the options given below:
Correct Answer: (b)
Excretion is by Malpighian tubules, Fat body, Nephrocytes, and Urecose glands.
Excretion is by Malpighian tubules, Fat body, Nephrocytes, and Urecose glands.
Q96. Which one of the following is NOT an advantage of inbreeding?
Correct Answer: (c)
Inbreeding depression (decreased productivity) is a disadvantage.
Inbreeding depression (decreased productivity) is a disadvantage.
Q97. Given below are two statements:
Statement I : In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II : In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below :
Statement I : In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II : In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below :
Correct Answer: (c)
Statement I is false (DNA is negative, proteins are positive). Statement II is true.
Statement I is false (DNA is negative, proteins are positive). Statement II is true.
Q98. Among eukaryotes, replication of DNA takes place in -
Correct Answer: (a)
DNA replication occurs during the S phase (Synthesis phase) of the cell cycle.
DNA replication occurs during the S phase (Synthesis phase) of the cell cycle.
Q99. Which of the following is not a cloning vector ?
Correct Answer: (c)
Probe is a labelled DNA/RNA sequence, not a vector.
Probe is a labelled DNA/RNA sequence, not a vector.
Q100. Match List I with List II.
| List I | List II |
|---|---|
| A. Vasectomy | I. Oral method |
| B. Coitus interruptus | II. Barrier method |
| C. Cervical caps | III. Surgical method |
| D. Saheli | IV. Natural method |
Correct Answer: (a)
Vasectomy-Surgical (III), Coitus interruptus-Natural (IV), Cervical caps-Barrier (II), Saheli-Oral (I).
Vasectomy-Surgical (III), Coitus interruptus-Natural (IV), Cervical caps-Barrier (II), Saheli-Oral (I).